| Identification |
| Name: |
Histidine biosynthesis bifunctional protein hisIE |
| Synonyms: |
- Phosphoribosyl-AMP cyclohydrolase
- PRA-CH
- Phosphoribosyl-ATP pyrophosphatase
- PRA-PH
|
| Gene Name: |
hisI |
| Enzyme Class: |
|
| Biological Properties |
| General Function: |
Involved in phosphoribosyl-AMP cyclohydrolase activity |
| Specific Function: |
1-(5-phosphoribosyl)-ATP + H(2)O = 1-(5- phosphoribosyl)-AMP + diphosphate |
| Cellular Location: |
Cytoplasm |
| KEGG Pathways: |
|
| KEGG Reactions: |
|
| SMPDB Reactions: |
|
Phosphoribosyl-ATP | + |  | + |  | → |  | + | Pyrophosphate | + |  |
| | | |
|
| PseudoCyc/BioCyc Reactions: |
|
| Complex Reactions: |
Not Available |
| Transports: |
Not Available |
| Metabolites: |
|
| GO Classification: |
| Function |
|---|
| catalytic activity | | cyclohydrolase activity | | hydrolase activity | | hydrolase activity, acting on acid anhydrides | | hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides | | hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds | | hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines | | phosphoribosyl-AMP cyclohydrolase activity | | phosphoribosyl-ATP diphosphatase activity | | pyrophosphatase activity | | Process |
|---|
| cellular amino acid and derivative metabolic process | | cellular amino acid metabolic process | | cellular metabolic process | | histidine biosynthetic process | | histidine family amino acid metabolic process | | histidine metabolic process | | metabolic process |
|
| Gene Properties |
| Locus tag: |
PA5066 |
| Strand: |
+ |
| Entrez Gene ID: |
878019 |
| Accession: |
NP_253753.1 |
| GI: |
15600259 |
| Sequence start: |
5705794 |
| Sequence End: |
5706198 |
| Sequence Length: |
404 |
| Gene Sequence: |
>PA5066
ATGAAAGACTGGCTGGATGAGATTCACTGGAACGCCGACGGCCTGGTCCCGGCGATCGCCCAGGATCACGAGACCGGGCGCGTGCTGATGATGGCCTGGATGAACCGCGAGGCGCTGGCCCTGACCGCCAGCGAGAACCGTGCAATCTATTGGTCGCGTTCGCGTGGCAAGCTGTGGCGCAAGGGCGAGGAGTCCGGGCACGTGCAGAAGCTGCACGAACTGCGTCTGGACTGCGACGCCGACGTGGTCATCCTGATGGTCGAGCAGGTCGGCGGGATCGCCTGCCATACCGGCCGGGAAAGCTGTTTCTACCGCGTCTTCGAGAACGGCGCCTGGAAGACCGTCGATCCGGTGCTGAAGGACCCGGACGCTATCTACGAACACGCAGGACACCACCATGAGTGA |
| Protein Properties |
| Protein Residues: |
134 |
| Protein Molecular Weight: |
15.4 kDa |
| Protein Theoretical pI: |
6.01 |
| Hydropathicity (GRAVY score): |
-0.465 |
| Charge at pH 7 (predicted): |
-4.93 |
| Protein Sequence: |
>PA5066
MKDWLDEIHWNADGLVPAIAQDHETGRVLMMAWMNREALALTASENRAIYWSRSRGKLWRKGEESGHVQKLHELRLDCDADVVILMVEQVGGIACHTGRESCFYRVFENGAWKTVDPVLKDPDAIYEHAGHHHE |
| References |
| External Links: |
|
| General Reference: |
PaperBLAST - Find papers about PA5066 and its homologs
|