| Identification |
| Name: |
Tryptophan biosynthesis protein trpCF |
| Synonyms: |
- Indole-3-glycerol phosphate synthase
- IGPS
- N-(5'-phospho-ribosyl)anthranilate isomerase
- PRAI
|
| Gene Name: |
trpC |
| Enzyme Class: |
|
| Biological Properties |
| General Function: |
Involved in catalytic activity |
| Specific Function: |
Bifunctional enzyme that catalyzes two sequential steps of tryptophan biosynthetic pathway. The first reaction is catalyzed by the isomerase, coded by the trpF domain; the second reaction is catalyzed by the synthase, coded by the trpC domain |
| Cellular Location: |
Not Available |
| KEGG Pathways: |
|
| KEGG Reactions: |
| | |
 | → |  |
| | | |
|
| SMPDB Reactions: |
|
N-(5-phosphoribosyl)-anthranilate | + |  | → | 1-(o-carboxyphenylamino)-1'-deoxyribulose 5'-phosphate | + |  |
| | |
1-(o-carboxyphenylamino)-1'-deoxyribulose 5'-phosphate | + |  | + |  | → |  | + |  |
| | |
1-(o-carboxyphenylamino)-1'-deoxyribulose 5'-phosphate | + |  | + |  | → |  | + |  | + | (1S,2R)-1-C-(indol-3-yl)glycerol 3-phosphate | + |  |
| | |
N-(5-phosphoribosyl)-anthranilate | + |  | → |  |
| | |
 | + |  | → |  | + |  | + | (1S,2R)-1-C-(indol-3-yl)glycerol 3-phosphate | + |  |
| |
|
| PseudoCyc/BioCyc Reactions: |
| | | | |
 | → |  |
| |
|
| Complex Reactions: |
Not Available |
| Transports: |
Not Available |
| Metabolites: |
| PAMDB ID | Name | View |
|---|
| PAMDB006317 | N-(5-phosphoribosyl)-anthranilate | MetaboCard | | PAMDB006319 | (1S,2R)-1-C-(indol-3-yl)glycerol 3-phosphate | MetaboCard | | PAMDB000868 | 1-(2-Carboxyphenylamino)-1'-deoxy-D-ribulose 5'-phosphate | MetaboCard | | PAMDB001862 | 1-(2-Carboxyphenylamino)-1'-deoxyribulose-5'-phosphate | MetaboCard | | PAMDB006318 | 1-(o-carboxyphenylamino)-1'-deoxyribulose 5'-phosphate | MetaboCard | | PAMDB000568 | Carbon dioxide | MetaboCard | | PAMDB001633 | Hydrogen ion | MetaboCard | | PAMDB001007 | Indoleglycerol phosphate | MetaboCard | | PAMDB001021 | N-(5-Phospho-D-ribosyl)anthranilate | MetaboCard | | PAMDB000142 | Water | MetaboCard |
|
| GO Classification: |
| Function |
|---|
| carbon-carbon lyase activity | | carboxy-lyase activity | | catalytic activity | | indole-3-glycerol-phosphate synthase activity | | intramolecular oxidoreductase activity | | intramolecular oxidoreductase activity, interconverting aldoses and ketoses | | isomerase activity | | lyase activity | | phosphoribosylanthranilate isomerase activity | | Process |
|---|
| cellular amino acid and derivative metabolic process | | cellular amino acid derivative metabolic process | | cellular biogenic amine metabolic process | | cellular metabolic process | | indolalkylamine metabolic process | | metabolic process | | tryptophan metabolic process |
|
| Gene Properties |
| Locus tag: |
PA0651 |
| Strand: |
+ |
| Entrez Gene ID: |
882120 |
| Accession: |
NP_249342.1 |
| GI: |
15595848 |
| Sequence start: |
705130 |
| Sequence End: |
705966 |
| Sequence Length: |
836 |
| Gene Sequence: |
>PA0651
GTGAGTGTGCCGACGGTTCTGCAGAAGATCCTCGCCCGCAAGGCCGAGGAGGTCGCCGAGCGCCGTGCGCGCGTCAACCTGGCAGAGGTCGAGCGGCTGGCGCGTAGCGCCGATGCGCCGCGCGGCTTCGCCAATGCCCTGCTGGAGCGGGCCAAGCGCAAGGAGCCGGCAGTGATCGCCGAGATCAAGAAGGCATCGCCGAGCAAGGGCGTGCTGCGCGAACACTTCGTCCCGGCGGAGATCGCCCGCAGCTACGAGGCGGGTGGCGCGGCGTGCCTGTCGGTGCTCACCGACGTGGACTTCTTCCAGGGCGCCGATGCCTATCTGAAGGAAGCGCGGGCCGCCTGTGCGCTGCCGGTGATCCGCAAGGACTTCATGATCGATCCGTACCAGATCGTCGAGGCGCGGGCGATCGGTGCCGACTGCATCCTGCTGATCGTCTCGGCGCTGGACGACGTGCTGATGGCCGAACTGGCGGCGACTGCCAAGTCGGTCGGTCTCGACGTACTGGTCGAAGTGCATGACGGCACCGAGCTGGAACGTGCACTGAAGACCCTGGACACGCCGTTGGTGGGCATCAACAACCGCAACCTGCACACCTTCGAGGTGAGCCTGGAAACCACCCTCGACCTGTTGCCGGAAATTCCCCGCGACCGCCTGGTGGTCACCGAGAGCGGTATTCTCAACCGGGCCGACGTGGAGCTGATGGAAGTCAGCGAGGTCTACGCCTTCCTGGTTGGCGAGGCGTTCATGCGGGCCGACGATCCTGGCCTCGAGCTGAAGCGCCTGTTCTTCCAGGAGCGTGGTGCTGTGGTGCTGGGCGCCGATCCTGACTGA |
| Protein Properties |
| Protein Residues: |
278 |
| Protein Molecular Weight: |
30.3 kDa |
| Protein Theoretical pI: |
4.64 |
| Hydropathicity (GRAVY score): |
0.112 |
| Charge at pH 7 (predicted): |
-11.35 |
| Protein Sequence: |
>PA0651
MSVPTVLQKILARKAEEVAERRARVNLAEVERLARSADAPRGFANALLERAKRKEPAVIAEIKKASPSKGVLREHFVPAEIARSYEAGGAACLSVLTDVDFFQGADAYLKEARAACALPVIRKDFMIDPYQIVEARAIGADCILLIVSALDDVLMAELAATAKSVGLDVLVEVHDGTELERALKTLDTPLVGINNRNLHTFEVSLETTLDLLPEIPRDRLVVTESGILNRADVELMEVSEVYAFLVGEAFMRADDPGLELKRLFFQERGAVVLGADPD |
| References |
| External Links: |
|
| General Reference: |
PaperBLAST - Find papers about PA0651 and its homologs
|