| Identification |
| Name: |
Protein-L-isoaspartate O-methyltransferase |
| Synonyms: |
- L-isoaspartyl protein carboxyl methyltransferase
- Protein L-isoaspartyl methyltransferase
- Protein-beta-aspartate methyltransferase
- PIMT
|
| Gene Name: |
pcm |
| Enzyme Class: |
|
| Biological Properties |
| General Function: |
Involved in protein-L-isoaspartate (D-aspartate) O-methyltransferase activity |
| Specific Function: |
Catalyzes the methyl esterification of L-isoaspartyl residues in peptides and proteins that result from spontaneous decomposition of normal L-aspartyl and L-asparaginyl residues. It plays a role in the repair and/or degradation of damaged proteins. This enzyme does not act on D-aspartyl residues |
| Cellular Location: |
Cytoplasm |
| KEGG Pathways: |
Not Available |
| KEGG Reactions: |
|
 | + | Protein L-isoaspartate | ↔ |  | + | Protein L-isoaspartate methyl ester |
| |
|
| SMPDB Reactions: |
Not Available |
| PseudoCyc/BioCyc Reactions: |
|
| + | a [protein]-L-β-isoaspartate | → | | + | a protein L-β-isoaspartate α-methyl ester | + |  |
| |
|
| Complex Reactions: |
Not Available |
| Transports: |
Not Available |
| Metabolites: |
|
| GO Classification: |
| Function |
|---|
| catalytic activity | | methyltransferase activity | | protein-L-isoaspartate (D-aspartate) O-methyltransferase activity | | S-adenosylmethionine-dependent methyltransferase activity | | transferase activity | | transferase activity, transferring one-carbon groups | | Process |
|---|
| macromolecule metabolic process | | macromolecule modification | | metabolic process | | protein modification process |
|
| Gene Properties |
| Locus tag: |
PA3624 |
| Strand: |
- |
| Entrez Gene ID: |
880441 |
| Accession: |
NP_252314.1 |
| GI: |
15598820 |
| Sequence start: |
4059957 |
| Sequence End: |
4060592 |
| Sequence Length: |
635 |
| Gene Sequence: |
>PA3624
ATGACCTCCCAGCGTACCCGAGAGCGCCTGATCCAGCGCCTGTACGAAGAAGGCCTTTCCAACGCCCACGTGCTCGAGGTGATCCGCCGCACGCCGCGTCATCTGTTCGTCGACGAGGCGCTCTCGCATCGCGCCTACGAAGACACCGCCCTGCCGATCGGCCACAACCAGACCATTTCCCAGCCGTTCATGGTGGCGCGGATGACCGAGTTGCTGCTGGCGGCCGGCCCGCTGGACAAGGTCATGGAGATCGGCACCGGGTCCGGCTACCAGACCGCGGTGCTGGCGCAACTGGTCGAGCGGGTCTTCTCCGTCGAGCGGATCCAGGCGTTGCAGGACAAGGCCAAGGAGCGTCTTGCGGAGCTAAACCTGCGTAATGTTGTCTTTCGTTGGGGCGATGGCTGGGAGGGTTGGTCGGCGTTGGCTCCCTACAATGGAATCATCGTCACCGCGGCGGCCACGGAAGTCCCGCAGTCGTTGCTGGACCAGTTGGCGCCTGGGGGGCGCCTGGTGATCCCGGTCGGTGGCGGCGAGGTCCAGCAACTGATGCTGATCGTCCGCACCGAGGACGGGTTCAGCCGCCAGGTACTCGACTCGGTACGTTTCGTCCCGCTGCTCAACGGCCCGATCGCCTGA |
| Protein Properties |
| Protein Residues: |
211 |
| Protein Molecular Weight: |
23.4 kDa |
| Protein Theoretical pI: |
6.13 |
| Hydropathicity (GRAVY score): |
-0.027 |
| Charge at pH 7 (predicted): |
-2.04 |
| Protein Sequence: |
>PA3624
MTSQRTRERLIQRLYEEGLSNAHVLEVIRRTPRHLFVDEALSHRAYEDTALPIGHNQTISQPFMVARMTELLLAAGPLDKVMEIGTGSGYQTAVLAQLVERVFSVERIQALQDKAKERLAELNLRNVVFRWGDGWEGWSALAPYNGIIVTAAATEVPQSLLDQLAPGGRLVIPVGGGEVQQLMLIVRTEDGFSRQVLDSVRFVPLLNGPIA |
| References |
| External Links: |
|
| General Reference: |
PaperBLAST - Find papers about PA3624 and its homologs
|
