Multifunctional CCA protein (PA0584)

Identification
Name: Multifunctional CCA protein
Synonyms:
  • CCA-adding enzyme
  • tRNA CCA-pyrophosphorylase
  • tRNA adenylyl-/cytidylyl-transferase
  • tRNA nucleotidyltransferase
  • tRNA-NT
  • 2'-nucleotidase
  • 2',3'-cyclic phosphodiesterase
  • Phosphatase
Gene Name: cca
Enzyme Class:
Biological Properties
General Function: Involved in RNA binding
Specific Function: Catalyzes the addition and repair of the essential 3'- terminal CCA sequence in tRNAs without using a nucleic acid template. Adds these three nucleotides in the order of C, C, and A to the tRNA nucleotide-73, using CTP and ATP as substrates and producing inorganic pyrophosphate. Also shows highest phosphatase activity in the presence of Ni(2+) and hydrolyzes pyrophosphate, canonical 5'-nucleoside tri- and diphosphates, NADP, and 2'-AMP with the production of Pi. Displays a metal-independent phosphodiesterase activity toward 2',3'-cAMP, 2',3'-cGMP, and 2',3'-cCMP. Without metal or in the presence of Mg(2+), this protein hydrolyzes 2',3'-cyclic substrates with the formation of 2'-nucleotides, whereas in the presence of Ni(2+), it also produces some 3'-nucleotides. These phosphohydrolase activities are probably involved in the repair of the tRNA 3'-CCA terminus degraded by intracellular RNases
Cellular Location: Cytoplasmic
KEGG Pathways: Not Available
KEGG Reactions:
tRNA precursor+2 Thumb+Thumb ↔ tRNA with a 3' CCA end+3 Thumb
tRNA precursor + 2 Cytidine triphosphate + Adenosine triphosphate ↔ tRNA with a 3' CCA end + 3 Pyrophosphate
ReactionCard
tRNA precursor+Thumb ↔ tRNA with a 3' cytidine+Thumb
tRNA precursor + Cytidine triphosphate ↔ tRNA with a 3' cytidine + Pyrophosphate
ReactionCard
tRNA with a 3' cytidine+Thumb ↔ tRNA with a 3' CC end+Thumb
tRNA with a 3' cytidine + Cytidine triphosphate ↔ tRNA with a 3' CC end + Pyrophosphate
ReactionCard
tRNA with a 3' CC end+Thumb ↔ tRNA with a 3' CCA end+Thumb
tRNA with a 3' CC end + Adenosine triphosphate ↔ tRNA with a 3' CCA end + Pyrophosphate
ReactionCard
tRNA precursor+2 Thumb+Thumb+tRNA with a 3' cytidine+tRNA with a 3' CC end ↔ tRNA with a 3' CCA end+3 Thumb
tRNA precursor + 2 Cytidine triphosphate + Adenosine triphosphate + tRNA with a 3' cytidine + tRNA with a 3' CC end ↔ tRNA with a 3' CCA end + 3 Pyrophosphate
ReactionCard
SMPDB Reactions: Not Available
PseudoCyc/BioCyc Reactions:
tRNA precursor+2 Thumb+Thumb ↔ tRNA with a 3' CCA end+3 Thumb
tRNA precursor + 2 Cytidine triphosphate + Adenosine triphosphate ↔ tRNA with a 3' CCA end + 3 Pyrophosphate
ReactionCard
tRNA precursor+Thumb ↔ tRNA with a 3' cytidine+Thumb
tRNA precursor + Cytidine triphosphate ↔ tRNA with a 3' cytidine + Pyrophosphate
ReactionCard
tRNA with a 3' cytidine+Thumb ↔ tRNA with a 3' CC end+Thumb
tRNA with a 3' cytidine + Cytidine triphosphate ↔ tRNA with a 3' CC end + Pyrophosphate
ReactionCard
tRNA with a 3' CC end+Thumb ↔ tRNA with a 3' CCA end+Thumb
tRNA with a 3' CC end + Adenosine triphosphate ↔ tRNA with a 3' CCA end + Pyrophosphate
ReactionCard
A tRNA precursor+2 Thumb+Thumb → a tRNA with a 3' CCA end+3 Thumb
A tRNA precursor + 2 Cytidine triphosphate + Adenosine triphosphate → a tRNA with a 3' CCA end + 3 Pyrophosphate
ReactionCard
tRNA precursor+2 Thumb+Thumb+tRNA with a 3' cytidine+tRNA with a 3' CC end ↔ tRNA with a 3' CCA end+3 Thumb
tRNA precursor + 2 Cytidine triphosphate + Adenosine triphosphate + tRNA with a 3' cytidine + tRNA with a 3' CC end ↔ tRNA with a 3' CCA end + 3 Pyrophosphate
ReactionCard
Thumb
RNA(n+1) + phosphate = RNA(n) + a nucleoside diphosphate
ReactionCard
PAMDB110244 → Ribonucleoside-Diphosphates
phosphate → Ribonucleoside-Diphosphates
ReactionCard
PAMDB120468+PAMDB000142 → PAMDB120381+PAMDB001633
adenosine 2',3'-cyclic monophosphate + Water → adenosine 3'-monophosphate + Hydrogen ion
ReactionCard
PAMDB120475+PAMDB000142 → PAMDB120019+PAMDB001633
cytidine 2',3'-cyclic monophosphate + Water → cytidine-3'-monophosphate + Hydrogen ion
ReactionCard
PAMDB120483+PAMDB000142 → PAMDB120078+PAMDB001633
uridine 2'3'-cyclic monophosphate + Water → uridine 3'-monophosphate + Hydrogen ion
ReactionCard
PAMDB120487+PAMDB000142 → PAMDB120124+PAMDB001633
guanosine 2',3'-cyclic monophosphate + Water → guanosine 3'-monophosphate + Hydrogen ion
ReactionCard
Cyclic-2-3-Nucleoside-Monophosphates+PAMDB000142 → 3-Prime-Ribonucleoside-Monophosphates+PAMDB001633
Cyclic-2-3-Nucleoside-Monophosphates + Water → 3-Prime-Ribonucleoside-Monophosphates + Hydrogen ion
ReactionCard
PAMDB110525+PAMDB110477 → PAMDB110246
CTP + ATP → diphosphate
ReactionCard
Complex Reactions:
A tRNA precursor+2 Thumb+Thumb → a tRNA with a 3' CCA end+3 Thumb
A tRNA precursor + 2 Cytidine triphosphate + Adenosine triphosphate → a tRNA with a 3' CCA end + 3 Pyrophosphate
ReactionCard
Transports: Not Available
Metabolites:
PAMDB IDNameView
PAMDB000148Adenosine triphosphateMetaboCard
PAMDB000030Cytidine triphosphateMetaboCard
PAMDB000633PyrophosphateMetaboCard
GO Classification:
Function
adenyl nucleotide binding
adenyl ribonucleotide binding
adenylyltransferase activity
ATP binding
binding
catalytic activity
nucleic acid binding
nucleoside binding
nucleotidyltransferase activity
purine nucleoside binding
RNA binding
transferase activity
transferase activity, transferring phosphorus-containing groups
tRNA adenylyltransferase activity
Process
cellular macromolecule metabolic process
macromolecule metabolic process
metabolic process
ncRNA metabolic process
RNA metabolic process
RNA processing
tRNA 3'-end processing
tRNA 3'-terminal CCA addition
tRNA metabolic process
tRNA processing
Gene Properties
Locus tag: PA0584
Strand: -
Entrez Gene ID: 877618
Accession: NP_249275.1
GI: 15595781
Sequence start: 641932
Sequence End: 643164
Sequence Length: 1232
Gene Sequence: 
>PA0584
ATGCAGATTTACAAGGTCGGCGGCGCCGTGCGCGATCGCCTTCTCGGCCGTCCGGTCACCGATATCGACTGGGTGGTGGTCGGTGCCAGCAGCGACGAGATGCTCGCCCGCGGCTACCGCCCGGTGGGCGCCGACTTCCCGGTCTTCCTTCATCCGCAGAGCGGCGAGGAATACGCCCTGGCGCGCACTGAGCGAAAGAGCGGGCGCGGCTACGGCGGCTTCACCTTCCATGCCAGCCCCGAGGTGACCCTGGAGGAAGACCTGACTCGCCGTGACCTGACCATCAACGCCATGGCCGAGGACGAACAGGGCCGGGTAATAGACCCCTACGGCGGCCAGGCCGACCTCGAGGCGCGCCTGCTGCGCCACGTTTCCCCGGCGTTCGCCGAGGATCCCCTGCGGGTCCTGCGCGTAGCGCGCTTCGCCGCCCGCTACGCCGGCCTGGGCTTCCGGGTCGCCGCCGAAACCCTCGCCCTGATGCGCCAACTGGCGGAATCCGGCGAGTTGCAGGCGCTGACCCCGGAGCGCAGTTGGAAGGAAATTTCCCGAGCCCTGATGGAACCCAACCCCGAGGTCTTCATCCAGGTCCTGCACGACTGCGGCGCCCTGGCCGAACTGATCCCAGAAGTCGAGGCGCTATTCGGCGTACCGCAGCCGGCGGCCCACCATCCGGAAATCGATACCGGCGTCCATGTCCTGTCGGTATTGCAGCAATGCGCCCGCCACCGGCAGCCGCTCAGCGTACGCTGGGCCTGCCTGCTGCACGACCTGGGCAAGGGACTCACCAGCGAAGCGGACTGGCCCCGCCATATCGCCCACGAGGCTCGCGGCGTGCCGTTGATCGATGCGGTGAACCAGCGCTTCAGGGTGCCGCGCGAGTGCCAGGAACTGGCGCGCCTGGTGGGCGAGTACCACACCCACGCCCATCGGGCGCTGGAGCTGCGCCCGAATACACTGCTGGAGCTGTTGCAGAGCTTCGACGTGTATCGCCGCCCGCAGCGTTTCGAGGAGTTCGTCGCCGCCAGCGAGATGGACGCGCGCGGCCGCCTCGGCCTGGAACAGCGGGACTATCCGCAGGCCGCCTACTTGCTCGGCGCGGCGCAGGCAGCGCGGGCAGTCAGCGTGAAGCCGCTGGTGGAAAAGGGCTTGAAGGGCGCGGAACTGGGCGAGGCGCTGAAGCGTGCGCGCCTCGCCGCACTCAAGGCCTACAAGGAAGAACGCGGAAAGGCCTGA
Protein Properties
Protein Residues: 410
Protein Molecular Weight: 45.6 kDa
Protein Theoretical pI: 6.89
Hydropathicity (GRAVY score): -0.294
Charge at pH 7 (predicted): -0.73
Protein Sequence: 
>PA0584
MQIYKVGGAVRDRLLGRPVTDIDWVVVGASSDEMLARGYRPVGADFPVFLHPQSGEEYALARTERKSGRGYGGFTFHASPEVTLEEDLTRRDLTINAMAEDEQGRVIDPYGGQADLEARLLRHVSPAFAEDPLRVLRVARFAARYAGLGFRVAAETLALMRQLAESGELQALTPERSWKEISRALMEPNPEVFIQVLHDCGALAELIPEVEALFGVPQPAAHHPEIDTGVHVLSVLQQCARHRQPLSVRWACLLHDLGKGLTSEADWPRHIAHEARGVPLIDAVNQRFRVPRECQELARLVGEYHTHAHRALELRPNTLLELLQSFDVYRRPQRFEEFVAASEMDARGRLGLEQRDYPQAAYLLGAAQAARAVSVKPLVEKGLKGAELGEALKRARLAALKAYKEERGKA
References
External Links:
Resource Link
Genome ID: PA0584
Entrez Gene ID: 877618
NCBI Protein ID: 15595781
General Reference: PaperBLAST - Find papers about PA0584 and its homologs