ErsA (PA5492.1)
Identification | |||||||||
---|---|---|---|---|---|---|---|---|---|
Name: | ErsA | ||||||||
Synonyms: | Not Available | ||||||||
Gene Name: | ersA | ||||||||
Enzyme Class: | Not Available | ||||||||
Biological Properties | |||||||||
General Function: | cellular response to heat, cellular response to cell envelope stress, response to decreased oxygen levels, posttranscriptional regulation of gene expression | ||||||||
Specific Function: | mRNA binding | ||||||||
Cellular Location: | Not Available | ||||||||
KEGG Pathways: |
| ||||||||
KEGG Reactions: | Not Available | ||||||||
SMPDB Reactions: | Not Available | ||||||||
PseudoCyc/BioCyc Reactions: |
| ||||||||
Complex Reactions: | Not Available | ||||||||
Transports: | Not Available | ||||||||
Metabolites: | Not Available | ||||||||
GO Classification: |
| ||||||||
Gene Properties | |||||||||
Locus tag: | PA5492.1 | ||||||||
Strand: | - | ||||||||
Entrez Gene ID: | Not Available | ||||||||
Accession: | Not Available | ||||||||
GI: | Not Available | ||||||||
Sequence start: | 6183530 | ||||||||
Sequence End: | 6183661 | ||||||||
Sequence Length: | 131 | ||||||||
Gene Sequence: |
>PA5492.1 AAAAAAAACCCCGAGCTTCGTATGGGGAGGGGGAAGTTCGGGGTTCAAGTCCGGACCGCTAGGGCGGGGTCCAGGAATCTGCCAACACTAAACACTGCAAAGGAGCATCGAAGGGCTCAAGAAGCCATTCGT | ||||||||
Protein Properties | |||||||||
Protein Residues: | 43 | ||||||||
Protein Molecular Weight: | Not Available kDa | ||||||||
Protein Theoretical pI: | Not Available | ||||||||
Hydropathicity (GRAVY score): | Not Available | ||||||||
Charge at pH 7 (predicted): | Not Available | ||||||||
Protein Sequence: |
>PA5492.1
Not Available | ||||||||
References | |||||||||
External Links: |
| ||||||||
General Reference: | PaperBLAST - Find papers about PA5492.1 and its homologs |