
nitrogen-regulated sRNA, NrsZ (PA5125.1)
Identification | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
Name: | nitrogen-regulated sRNA, NrsZ | |||||||||
Synonyms: | Not Available | |||||||||
Gene Name: | nrsZ | |||||||||
Enzyme Class: | Not Available | |||||||||
Biological Properties | ||||||||||
General Function: | pathogenesis, bacterial-type flagellum-dependent swarming motility, cellular response to nitrogen starvation, regulation of bacterial-type flagellum-dependent cell motility, pathogenesis, bacterial-type flagellum-dependent swarming motility, cellular response to nitrogen starvation, regulation of bacterial-type flagellum-dependent cell motility | |||||||||
Specific Function: | Not Available | |||||||||
Cellular Location: | Not Available | |||||||||
KEGG Pathways: |
| |||||||||
KEGG Reactions: | Not Available | |||||||||
SMPDB Reactions: | Not Available | |||||||||
PseudoCyc/BioCyc Reactions: |
| |||||||||
Complex Reactions: | Not Available | |||||||||
Transports: | Not Available | |||||||||
Metabolites: | Not Available | |||||||||
GO Classification: |
| |||||||||
Gene Properties | ||||||||||
Locus tag: | PA5125.1 | |||||||||
Strand: | + | |||||||||
Entrez Gene ID: | Not Available | |||||||||
Accession: | Not Available | |||||||||
GI: | Not Available | |||||||||
Sequence start: | 5775397 | |||||||||
Sequence End: | 5775623 | |||||||||
Sequence Length: | 226 | |||||||||
Gene Sequence: |
>PA5125.1 AACGAAGATTTCGGGGGCCTCGGTACAGGCAGGCTGGGGAATCCCCTCTTTTACACCCGGCGGCAGACGCAGCATCCGCGCGCAACCGCCACACCCGTTTCGGGGACCTCGGTACAGGCAGGCTGAGAACTCCCCTCTTTTATGCCCGGCGGTAGCGCAGCGATCCGCGCCTCCGCCCTCCCGTTTGGGGACCTCGGTACAGGCAGGCTGAGAATTCCCCCTTTTAT | |||||||||
Protein Properties | ||||||||||
Protein Residues: | 75 | |||||||||
Protein Molecular Weight: | Not Available kDa | |||||||||
Protein Theoretical pI: | Not Available | |||||||||
Hydropathicity (GRAVY score): | Not Available | |||||||||
Charge at pH 7 (predicted): | Not Available | |||||||||
Protein Sequence: |
>PA5125.1
Not Available | |||||||||
References | ||||||||||
External Links: |
| |||||||||
General Reference: | PaperBLAST - Find papers about PA5125.1 and its homologs |