regulatory RNA PrrF1 (PA4704.1)
| Identification | |||||||||
|---|---|---|---|---|---|---|---|---|---|
| Name: | regulatory RNA PrrF1 | ||||||||
| Synonyms: | PrrF1 | ||||||||
| Gene Name: | prrF1 | ||||||||
| Enzyme Class: | Not Available | ||||||||
| Biological Properties | |||||||||
| General Function: | regulation of translation, regulation of metabolic process, negative regulation of translation, ncRNA-mediated, cellular response to iron ion starvation, regulation of cellular response to iron ion starvation, anthranilate catabolic process, regulation of carbon utilization | ||||||||
| Specific Function: | Not Available | ||||||||
| Cellular Location: | Not Available | ||||||||
| KEGG Pathways: |
| ||||||||
| KEGG Reactions: | Not Available | ||||||||
| SMPDB Reactions: | Not Available | ||||||||
| PseudoCyc/BioCyc Reactions: |
| ||||||||
| Complex Reactions: | Not Available | ||||||||
| Transports: | Not Available | ||||||||
| Metabolites: | Not Available | ||||||||
| GO Classification: |
| ||||||||
| Gene Properties | |||||||||
| Locus tag: | PA4704.1 | ||||||||
| Strand: | + | ||||||||
| Entrez Gene ID: | 4179187 | ||||||||
| Accession: | Not Available | ||||||||
| GI: | Not Available | ||||||||
| Sequence start: | 5283995 | ||||||||
| Sequence End: | 5284110 | ||||||||
| Sequence Length: | 115 | ||||||||
| Gene Sequence: |
>PA4704.1 AACTGGTCGCGAGATCAGCCGGTAAGCTGAGAGACCCACGCAGTCGGACTCTTCAGATTATCTCCTCATCAGGCTAATCACGGTTTTTGACCCGGCACTTTGCCGGGTCTTTTTTT | ||||||||
| Protein Properties | |||||||||
| Protein Residues: | 38 | ||||||||
| Protein Molecular Weight: | Not Available kDa | ||||||||
| Protein Theoretical pI: | Not Available | ||||||||
| Hydropathicity (GRAVY score): | Not Available | ||||||||
| Charge at pH 7 (predicted): | Not Available | ||||||||
| Protein Sequence: |
>PA4704.1
Not Available | ||||||||
| References | |||||||||
| External Links: |
| ||||||||
| General Reference: | PaperBLAST - Find papers about PA4704.1 and its homologs | ||||||||