transcriptional regulator MvaT, P16 subunit (PA4315)
| Identification | |||||||||
|---|---|---|---|---|---|---|---|---|---|
| Name: | transcriptional regulator MvaT, P16 subunit | ||||||||
| Synonyms: | Not Available | ||||||||
| Gene Name: | mvaT | ||||||||
| Enzyme Class: | Not Available | ||||||||
| Biological Properties | |||||||||
| General Function: | regulation of transcription, DNA-templated, regulation of L-arginine import, negative regulation of secondary metabolite biosynthetic process, negative regulation of single-species biofilm formation on inanimate substrate | ||||||||
| Specific Function: | transcription regulatory region DNA binding | ||||||||
| Cellular Location: | Cytoplasmic | ||||||||
| KEGG Pathways: |
| ||||||||
| KEGG Reactions: | Not Available | ||||||||
| SMPDB Reactions: | Not Available | ||||||||
| PseudoCyc/BioCyc Reactions: |
| ||||||||
| Complex Reactions: | Not Available | ||||||||
| Transports: | Not Available | ||||||||
| Metabolites: | Not Available | ||||||||
| GO Classification: |
| ||||||||
| Gene Properties | |||||||||
| Locus tag: | PA4315 | ||||||||
| Strand: | + | ||||||||
| Entrez Gene ID: | 881542 | ||||||||
| Accession: | NP_253005.1 | ||||||||
| GI: | 15599511 | ||||||||
| Sequence start: | 4843812 | ||||||||
| Sequence End: | 4844186 | ||||||||
| Sequence Length: | 374 | ||||||||
| Gene Sequence: |
>PA4315 ATGTCCCTGATCAACGAATATCGCGCCACGGAAGAAGCCATCAAGGAACTTCAGGAGCGCCTGAAGTCCCTGGAACAAGACGACAAACTGAAAAAAGAACTGGAATTCGAAGAGAAGCTGCGCACGCTGATGGGCACTTACCAGAAGTCCCTGCGTGACGTGATTTCCCTGCTCGATCCGGACGCCAAGATCGGCAAGAGCACCCGCACCGCCAAGGCACCTGCCGGCAAGCGCGCGCGCAAGGTCAAGCAGTACAAGAACCCGCACACCGGCGAAGTCATCGAGACCAAGGGCGGCAACCACAAGACTTTGAAAGAGTGGAAAGCCAAGTGGGGCCCCGAGGCCGTCGAGAGCTGGGCCACCCTGCTCGGCTAA | ||||||||
| Protein Properties | |||||||||
| Protein Residues: | 124 | ||||||||
| Protein Molecular Weight: | 14.2 kDa | ||||||||
| Protein Theoretical pI: | 10.14 | ||||||||
| Hydropathicity (GRAVY score): | -0.941 | ||||||||
| Charge at pH 7 (predicted): | 6.47 | ||||||||
| Protein Sequence: |
>PA4315 MSLINEYRATEEAIKELQERLKSLEQDDKLKKELEFEEKLRTLMGTYQKSLRDVISLLDPDAKIGKSTRTAKAPAGKRARKVKQYKNPHTGEVIETKGGNHKTLKEWKAKWGPEAVESWATLLG | ||||||||
| References | |||||||||
| External Links: |
| ||||||||
| General Reference: | PaperBLAST - Find papers about PA4315 and its homologs | ||||||||