two-component response regulator, PprB two-component response regulator, PprB (PA4296)

Identification
Name: two-component response regulator, PprB two-component response regulator, PprB
Synonyms: pprB
Gene Name: pprB
Enzyme Class: Not Available
Biological Properties
General Function: regulation of transcription, DNA-templated, phosphorelay signal transduction system, positive regulation of cell adhesion, positive regulation of single-species biofilm formation on inanimate substrate
Specific Function: sequence-specific DNA binding transcription factor activity, DNA binding, phosphorelay response regulator activity, transcription regulatory region DNA binding
Cellular Location: Cytoplasmic
KEGG Pathways:
    KEGG Reactions: Not Available
    SMPDB Reactions: Not Available
    PseudoCyc/BioCyc Reactions:
    Complex Reactions: Not Available
    Transports: Not Available
    Metabolites: Not Available
    GO Classification:
    Function
    sequence-specific DNA binding transcription factor activity
    DNA binding
    phosphorelay response regulator activity
    transcription regulatory region DNA binding
    Process
    regulation of transcription, DNA-templated
    phosphorelay signal transduction system
    positive regulation of cell adhesion
    positive regulation of single-species biofilm formation on inanimate substrate
    Gene Properties
    Locus tag: PA4296
    Strand: +
    Entrez Gene ID: 881658
    Accession: NP_252986.1
    GI: 15599492
    Sequence start: 4820532
    Sequence End: 4821359
    Sequence Length: 827
    Gene Sequence: 
    >PA4296
ATGGACAAACCGGCCTCGCGGCATTTCAGCGTCTTGATCATCGATGATGAACCCCAGGTGACCTCGGAACTCCGCGAACTGCTGGAAAACAGTGGCTACCGTTGCGTAACCAGCACCCACCGGGAGTCGGCGATCGCCAGCTTCCAGGCCGACCCGAACATCGGCCTGGTCATCTGCGACCTCTACCTGGGCCAGGACAACGGTATCCGCCTGATCGAGAGCCTCAAGGAAGTCGCCGGCAACGGCAGGTTCTTCGAATCGATCATCCTCACCGGTCACGATGGCCGCCAGGAAGTGATCGAGGCCATGCGGGTCGGCGCCGCCGACTACTACCAGAAACCGGTGGCGCCGCAGGAACTGCTGCATGGCCTCGAACGCCTGGAGAGCCGCCTGCACGAGCGCGTCCGCAGCCAGTTGAGCCTGAGCCACGTCAACCAGCGCCTGGAATACCTCGCCGAATCGCTGAACTCGATCTACCGCGACATCCACAAGATCAAGTACGAGGTACACGGCAACAGCCAGCCGAGCGCCCTCAGGAGCGAAGACAGCCAGCCGTCCGCGCCGCCGGCGCCGGTCGCGGAAAGCCAGGTGTCCCCGAGCAATCCGCTGTTCGGCAAGCTGTCGCCCCGCCAGCAGGCGGTGGCGCGGCTGGTGAGCAAGGGCCTGACCAACTACCAGATAGCCTACGAGCTGGGCATCACCGAGAACACGGTGAAGCTGTACGTCTCCCAGGTGCTGCGCCTGATGCATATGCACAACCGCACCCAGTTGGCGCTGGCCCTGTCGCCTGCGGCGATGCAGCAGGGCAGCGGAGCGGTGGTGCACTGA
    Protein Properties
    Protein Residues: 275
    Protein Molecular Weight: 30.6 kDa
    Protein Theoretical pI: 6.74
    Hydropathicity (GRAVY score): -0.329
    Charge at pH 7 (predicted): -1.42
    Protein Sequence: 
    >PA4296
MDKPASRHFSVLIIDDEPQVTSELRELLENSGYRCVTSTHRESAIASFQADPNIGLVICDLYLGQDNGIRLIESLKEVAGNGRFFESIILTGHDGRQEVIEAMRVGAADYYQKPVAPQELLHGLERLESRLHERVRSQLSLSHVNQRLEYLAESLNSIYRDIHKIKYEVHGNSQPSALRSEDSQPSAPPAPVAESQVSPSNPLFGKLSPRQQAVARLVSKGLTNYQIAYELGITENTVKLYVSQVLRLMHMHNRTQLALALSPAAMQQGSGAVVH
    References
    External Links:
    Resource Link
    Genome ID: PA4296
    Entrez Gene ID: 881658
    NCBI Protein ID: 15599492
    General Reference: PaperBLAST - Find papers about PA4296 and its homologs