Identification
Name: probable transcriptional regulator
Synonyms: yhdM
Gene Name: Not Available
Enzyme Class: Not Available
Biological Properties
General Function: regulation of transcription, DNA-templated, positive regulation of transcription, DNA-templated
Specific Function: DNA binding, sequence-specific DNA binding transcription factor activity, metal ion binding
Cellular Location: Cytoplasmic
KEGG Pathways:
    KEGG Reactions: Not Available
    SMPDB Reactions: Not Available
    PseudoCyc/BioCyc Reactions:
    Complex Reactions: Not Available
    Transports: Not Available
    Metabolites: Not Available
    GO Classification:
    Function
    DNA binding
    sequence-specific DNA binding transcription factor activity
    metal ion binding
    Process
    regulation of transcription, DNA-templated
    positive regulation of transcription, DNA-templated
    Gene Properties
    Locus tag: PA3689
    Strand: -
    Entrez Gene ID: 879126
    Accession: NP_252379.1
    GI: 15598885
    Sequence start: 4130952
    Sequence End: 4131422
    Sequence Length: 470
    Gene Sequence:
    >PA3689
    ATGAAGATCGGTGAGCTGGCGAAGAGAACCGGTTGCCCGGTGGAGACCATCCGCTACTACGAGCGCGAAGGCCTGTTGCCCGAGCCCGCGCGTAGCGAAGGCAACTATCGGCAATACACCCTGGCGCATGTCGAGCGCCTGTCGTTCATCCGTCACTGCCGCTCGCTGGACATGACCCAGGAGGAAATCCGTACCCTGCTGGCGTTGCGCGACCGTCCCGAGGCGGATTGCGGCACCGCCAACCGGTTGATCGACGAGCACCTGCATCACGTCGAGGTGCGCATCGCCGAACTCCAGGCATTGCGCGAGCAACTGCGGGATCTCGGCTCACGCTGTACGGTCGCCGGCAACAGCCAGGCCTGCGGCATCCTCCGCGAACTGGAGCAGCCCGCGCCGCTGTCGCCAATCGCCGAGGAATGCGCCGAGGCCGGGCACATGCACGTCCCCGGCGTGCACCGCCGGCATGGCTGA
    Protein Properties
    Protein Residues: 156
    Protein Molecular Weight: 17.7 kDa
    Protein Theoretical pI: 6.78
    Hydropathicity (GRAVY score): -0.559
    Charge at pH 7 (predicted): -1.02
    Protein Sequence:
    >PA3689
    MKIGELAKRTGCPVETIRYYEREGLLPEPARSEGNYRQYTLAHVERLSFIRHCRSLDMTQEEIRTLLALRDRPEADCGTANRLIDEHLHHVEVRIAELQALREQLRDLGSRCTVAGNSQACGILRELEQPAPLSPIAEECAEAGHMHVPGVHRRHG
    References
    External Links:
    Resource Link
    Genome ID: PA3689
    Entrez Gene ID: 879126
    NCBI Protein ID: 15598885
    General Reference: PaperBLAST - Find papers about PA3689 and its homologs