
D-erythro-7,8-dihydroneopterin triphosphate epimerase (PA3439)
| Identification | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Name: | D-erythro-7,8-dihydroneopterin triphosphate epimerase | ||||||||||||
| Synonyms: |
| ||||||||||||
| Gene Name: | folX | ||||||||||||
| Enzyme Class: | Not Available | ||||||||||||
| Biological Properties | |||||||||||||
| General Function: | Involved in dihydroneopterin aldolase activity | ||||||||||||
| Specific Function: | Catalyzes the epimerization of carbon 2' of the side chain of dihydroneopterin triphosphate (H2NTP) to form dihydromonapterin triphosphate (H2MTP) | ||||||||||||
| Cellular Location: | Not Available | ||||||||||||
| KEGG Pathways: |
| ||||||||||||
| KEGG Reactions: | Not Available | ||||||||||||
| SMPDB Reactions: |
| ||||||||||||
| PseudoCyc/BioCyc Reactions: |
| ||||||||||||
| Complex Reactions: | Not Available | ||||||||||||
| Transports: | Not Available | ||||||||||||
| Metabolites: |
| ||||||||||||
| GO Classification: |
| ||||||||||||
| Gene Properties | |||||||||||||
| Locus tag: | PA3439 | ||||||||||||
| Strand: | + | ||||||||||||
| Entrez Gene ID: | 877686 | ||||||||||||
| Accession: | NP_252129.1 | ||||||||||||
| GI: | 15598635 | ||||||||||||
| Sequence start: | 3846337 | ||||||||||||
| Sequence End: | 3846708 | ||||||||||||
| Sequence Length: | 371 | ||||||||||||
| Gene Sequence: |
>PA3439 ATGCCGCGACTGGAACCGGGAATGGCGCGAATCCGCGTCAAGGACCTGCGCCTGCGCACCTTCATCGGGATCAAGGAGGAGGAAATCCTCAACAAGCAGGACGTGCTGATCAACCTGACCATCCTCTACCCGGCCGCGGATGCCGTGGAGGTCAACGACATCGAGCACGCGCTGAACTACCGCACCATCACCAAGGCGATCATCCGCCACGTCGAGGAGAACCGCTTCGCCCTGCTCGAACGGATGACCCAGGAAATCCTCGACCTGGTGATGGAGAACCCGGCGGTGCGCTACGCCGAGGTGGAAGTGGACAAGCCGCACGCGCTGCGCTTCGCCGAGTCGGTCTCGATCACCCTCGCCGGCCACCGCTGA | ||||||||||||
| Protein Properties | |||||||||||||
| Protein Residues: | 123 | ||||||||||||
| Protein Molecular Weight: | 14.2 kDa | ||||||||||||
| Protein Theoretical pI: | 6.11 | ||||||||||||
| Hydropathicity (GRAVY score): | -0.133 | ||||||||||||
| Charge at pH 7 (predicted): | -2.04 | ||||||||||||
| Protein Sequence: |
>PA3439 MPRLEPGMARIRVKDLRLRTFIGIKEEEILNKQDVLINLTILYPAADAVEVNDIEHALNYRTITKAIIRHVEENRFALLERMTQEILDLVMENPAVRYAEVEVDKPHALRFAESVSITLAGHR | ||||||||||||
| References | |||||||||||||
| External Links: |
| ||||||||||||
| General Reference: | PaperBLAST - Find papers about PA3439 and its homologs | ||||||||||||