alginate and motility regulator Z AlgZ (PA3385)

Identification
Name: alginate and motility regulator Z AlgZ
Synonyms: algZ
Gene Name: amrZ
Enzyme Class: Not Available
Biological Properties
General Function: positive regulation of cell motility, positive regulation of single-species biofilm formation on inanimate substrate, bacterial-type flagellum assembly, regulation of transcription, DNA-templated, regulation of polysaccharide biosynthetic process, regulation of polysaccharide biosynthetic process, negative regulation of cyclic nucleotide biosynthetic process, pathogenesis, negative regulation of single-species biofilm formation on inanimate substrate, type IV pilus-dependent motility, negative regulation of bacterial-type flagellum-dependent cell motility
Specific Function: DNA binding, transcription regulatory region DNA binding, bacterial-type RNA polymerase enhancer sequence-specific DNA binding, bacterial-type RNA polymerase core promoter proximal region sequence-specific DNA binding
Cellular Location: Cytoplasmic
KEGG Pathways:
    KEGG Reactions: Not Available
    SMPDB Reactions: Not Available
    PseudoCyc/BioCyc Reactions:
    Complex Reactions: Not Available
    Transports: Not Available
    Metabolites: Not Available
    GO Classification:
    Function
    DNA binding
    transcription regulatory region DNA binding
    bacterial-type RNA polymerase enhancer sequence-specific DNA binding
    bacterial-type RNA polymerase core promoter proximal region sequence-specific DNA binding
    Process
    positive regulation of cell motility
    positive regulation of single-species biofilm formation on inanimate substrate
    bacterial-type flagellum assembly
    regulation of transcription, DNA-templated
    regulation of polysaccharide biosynthetic process
    regulation of polysaccharide biosynthetic process
    negative regulation of cyclic nucleotide biosynthetic process
    pathogenesis
    negative regulation of single-species biofilm formation on inanimate substrate
    type IV pilus-dependent motility
    negative regulation of bacterial-type flagellum-dependent cell motility
    Gene Properties
    Locus tag: PA3385
    Strand: +
    Entrez Gene ID: 878714
    Accession: NP_252075.1
    GI: 15598581
    Sequence start: 3791347
    Sequence End: 3791673
    Sequence Length: 326
    Gene Sequence: 
    >PA3385
ATGCGCCCACTGAAACAGGCAACTCCTACCTACTCCAGCCGTACCGCTGACAAATTCGTCGTTCGTCTGCCCGAGGGCATGCGTGAGCAGATCGCAGAAGTCGCTCGCAGCCATCACCGCAGCATGAACTCCGAGATCATCGCCCGACTCGAGCAGAGCCTGCTCCAGGAAGGGGCGCTGCAAGACAATCTCGGTGTTCGCCTGGACAGCCCGGAACTCAGCCTGCACGAGCGCGAGCTGCTGCAGCGTTTCCGCCAGCTGACCCACCGTCAGCAGAACGCGCTGGTCGCCCTGATCGCACACGATGCGGAGCTGGCCCAGGCCTGA
    Protein Properties
    Protein Residues: 108
    Protein Molecular Weight: 12.3 kDa
    Protein Theoretical pI: 7.93
    Hydropathicity (GRAVY score): -0.534
    Charge at pH 7 (predicted): 1.19
    Protein Sequence: 
    >PA3385
MRPLKQATPTYSSRTADKFVVRLPEGMREQIAEVARSHHRSMNSEIIARLEQSLLQEGALQDNLGVRLDSPELSLHERELLQRFRQLTHRQQNALVALIAHDAELAQA
    References
    External Links:
    Resource Link
    Genome ID: PA3385
    Entrez Gene ID: 878714
    NCBI Protein ID: 15598581
    General Reference: PaperBLAST - Find papers about PA3385 and its homologs