ECF sigma factor FoxI ECF sigma factor FoxI (PA2468)

Identification
Name: ECF sigma factor FoxI ECF sigma factor FoxI
Synonyms: foxI
Gene Name: foxI
Enzyme Class: Not Available
Biological Properties
General Function: DNA-templated transcription, initiation, regulation of transcription, DNA-templated, regulation of iron ion transport
Specific Function: sequence-specific DNA binding transcription factor activity, DNA binding, sigma factor activity, sigma factor activity
Cellular Location: Cytoplasmic
KEGG Pathways:
    KEGG Reactions: Not Available
    SMPDB Reactions: Not Available
    PseudoCyc/BioCyc Reactions:
    Complex Reactions: Not Available
    Transports: Not Available
    Metabolites: Not Available
    GO Classification:
    Component
    cytosol
    Function
    sequence-specific DNA binding transcription factor activity
    DNA binding
    sigma factor activity
    sigma factor activity
    Process
    DNA-templated transcription, initiation
    regulation of transcription, DNA-templated
    regulation of iron ion transport
    Gene Properties
    Locus tag: PA2468
    Strand: -
    Entrez Gene ID: 882912
    Accession: NP_251158.1
    GI: 15597664
    Sequence start: 2786365
    Sequence End: 2786883
    Sequence Length: 518
    Gene Sequence: 
    >PA2468
ATGTCCGCCCCGATCCTTCTCAGCGCCCACCATCGCGCCATGCATGCGCTGTACAGCGAGCACCATGGCTGGTTGCAGAACTGGCTGCGCGGCAAGCTGGGCTGCGCGGCGGACGCGGCGGACCTGGCCCAGGACACCTTCCTGCGCATCCTGCTCAAGCGCGAACTGCGCGAGATCGGCATGCCGCGCGCGTTCCTGCGGACCATCGCCCGCGGCCTGGTGATCGACCACTGGCGTCGCGAGGAACTGCAGCGCGCCTACCTCGAAAGCATCGCCCACCTGCCCGAGGCACAGGCGCCGTCGCCCGAGGCGCGGGAACTGGTGCTGGAACTGCTGGAGGAAATCTCGCGGATGCTCGACGGGCTCAAGCCGAAGGTCCGCACCGCCTTCCTCCTGGCCCAGTGCGAAGACCTCAGCCACCGGCAGATCGCCGAACGCATGGGGGTTTCCCAGCGTAGCGTCGAGCGCTACGTGGCCGAGGCGCTGTACCACTGCTACCTGCTGCGCTACGGCGAATGA
    Protein Properties
    Protein Residues: 172
    Protein Molecular Weight: 19.9 kDa
    Protein Theoretical pI: 7.7
    Hydropathicity (GRAVY score): -0.234
    Charge at pH 7 (predicted): 2.07
    Protein Sequence: 
    >PA2468
MSAPILLSAHHRAMHALYSEHHGWLQNWLRGKLGCAADAADLAQDTFLRILLKRELREIGMPRAFLRTIARGLVIDHWRREELQRAYLESIAHLPEAQAPSPEARELVLELLEEISRMLDGLKPKVRTAFLLAQCEDLSHRQIAERMGVSQRSVERYVAEALYHCYLLRYGE
    References
    External Links:
    Resource Link
    Genome ID: PA2468
    Entrez Gene ID: 882912
    NCBI Protein ID: 15597664
    General Reference: PaperBLAST - Find papers about PA2468 and its homologs