Identification
Name: nitrogen assimilation leader A (NalA)
Synonyms: P11
Gene Name: nalA
Enzyme Class: Not Available
Biological Properties
General Function: regulation of nitrate assimilation
Specific Function: Not Available
Cellular Location: Not Available
KEGG Pathways:
    KEGG Reactions: Not Available
    SMPDB Reactions: Not Available
    PseudoCyc/BioCyc Reactions:
    Complex Reactions: Not Available
    Transports: Not Available
    Metabolites: Not Available
    GO Classification:
    Process
    regulation of nitrate assimilation
    Gene Properties
    Locus tag: PA1781.1
    Strand: -
    Entrez Gene ID: 6965624
    Accession: Not Available
    GI: Not Available
    Sequence start: 1928666
    Sequence End: 1928886
    Sequence Length: 220
    Gene Sequence:
    >PA1781.1
    GGCGTCCCGCTGTTGCCAGCAGGACGCCTTTGTCCAGGTCCCGTTCGGTCGGGAAACGCCGCCTCGTCGTTGAGGCAGGCGCTTTGTTGTCGATTGTCGGGAGAACCCAAGCAGGCGCCGTGCCAACTTGCGCTGTTGCCTATCTCCATGGCCTTGCAGGGATAACGCGGGGCCTCCCCGCGGTCTTTCTGCCCCGTGCCGGGGCGTATCGCACCGAGCTG
    Protein Properties
    Protein Residues: 73
    Protein Molecular Weight: Not Available kDa
    Protein Theoretical pI: Not Available
    Hydropathicity (GRAVY score): Not Available
    Charge at pH 7 (predicted): Not Available
    Protein Sequence:
    >PA1781.1
    Not Available
    References
    External Links:
    Resource Link
    Genome ID: PA1781.1
    Entrez Gene ID: 6965624
    NCBI Protein ID: Not Available
    General Reference: PaperBLAST - Find papers about PA1781.1 and its homologs