Identification
Name: regulator in type III secretion
Synonyms: Not Available
Gene Name: pcrG
Enzyme Class: Not Available
Biological Properties
General Function: negative regulation of protein secretion
Specific Function: Not Available
Cellular Location: Unknown
KEGG Pathways:
    KEGG Reactions: Not Available
    SMPDB Reactions: Not Available
    PseudoCyc/BioCyc Reactions:
    Complex Reactions: Not Available
    Transports: Not Available
    Metabolites: Not Available
    GO Classification:
    Process
    negative regulation of protein secretion
    Gene Properties
    Locus tag: PA1705
    Strand: +
    Entrez Gene ID: 879383
    Accession: NP_250396
    GI: 15596902
    Sequence start: 1851991
    Sequence End: 1852278
    Sequence Length: 287
    Gene Sequence:
    >PA1705
    ATGAACGAATACACCGAAGACACCCTGCGGGCGACCGTCCAGGCCGCCGAACTGGCGATTCGCGACAGCGAGGAACGCGGCCGCCTGCTGGCGGAAATGTGGCAAGGCCTGGGGCTTGCCGCGGACGCCGGCGAGCTGCTGTTCCAGGCGCCGGAGCGAGAGCTGGCGCGAGCCGCCGAAGAGGAGCTGCTGGCCGAACTGCGGCGCATGCGCAGTTCCCAGCCGACGCAGGGCGAGCAGGGTACCCGGCCGCGGCGTCCGACGCCGATGCGTGGCTTGTTGATCTGA
    Protein Properties
    Protein Residues: 95
    Protein Molecular Weight: 11 kDa
    Protein Theoretical pI: 4.49
    Hydropathicity (GRAVY score): -0.652
    Charge at pH 7 (predicted): -5
    Protein Sequence:
    >PA1705
    MNEYTEDTLRATVQAAELAIRDSEERGRLLAEMWQGLGLAADAGELLFQAPERELARAAEEELLAELRRMRSSQPTQGEQGTRPRRPTPMRGLLI
    References
    External Links:
    Resource Link
    Genome ID: PA1705
    Entrez Gene ID: 879383
    NCBI Protein ID: 15596902
    General Reference: PaperBLAST - Find papers about PA1705 and its homologs