Identification
Name: hypothetical protein
Synonyms: helD; cycX; ccmD; pfcyt2
Gene Name: Not Available
Enzyme Class: Not Available
Biological Properties
General Function: cytochrome complex assembly, heme transport
Specific Function: Not Available
Cellular Location: Cytoplasmic Membrane
KEGG Pathways:
    KEGG Reactions: Not Available
    SMPDB Reactions: Not Available
    PseudoCyc/BioCyc Reactions:
    Complex Reactions: Not Available
    Transports: Not Available
    Metabolites: Not Available
    GO Classification:
    Component
    integral component of membrane
    Process
    cytochrome complex assembly
    heme transport
    Gene Properties
    Locus tag: PA1478
    Strand: +
    Entrez Gene ID: 880954
    Accession: NP_250169.1
    GI: 15596675
    Sequence start: 1604426
    Sequence End: 1604602
    Sequence Length: 176
    Gene Sequence:
    >PA1478
    ATGAGCTTCGAATCGTTCGGCGACTTCCTCGCCATGGGCCATCACGGTCCCTACGTCTGGTCGGCCTACGGCATCAGCCTGCTGGTGCTGGCGATCAATGTCGCCGAGCCGCTGCTGGCCCGGCGCCGCTACCTGCAAGAAGAGGCGCGTCGTCTGCGCCGGGAGGCCCAGCAGTGA
    Protein Properties
    Protein Residues: 58
    Protein Molecular Weight: 6.7 kDa
    Protein Theoretical pI: 9.07
    Hydropathicity (GRAVY score): -0.153
    Charge at pH 7 (predicted): 1.46
    Protein Sequence:
    >PA1478
    MSFESFGDFLAMGHHGPYVWSAYGISLLVLAINVAEPLLARRRYLQEEARRLRREAQQ
    References
    External Links:
    Resource Link
    Genome ID: PA1478
    Entrez Gene ID: 880954
    NCBI Protein ID: 15596675
    General Reference: PaperBLAST - Find papers about PA1478 and its homologs