Identification |
Name: |
transcriptional regulator FleQ |
Synonyms: |
Not Available |
Gene Name: |
fleQ |
Enzyme Class: |
Not Available |
Biological Properties |
General Function: |
regulation of transcription, DNA-templated, positive regulation of cilium-dependent cell motility, positive regulation of cell adhesion, transcription, DNA-templated, positive regulation of cell-substrate adhesion, negative regulation of extracellular matrix assembly, regulation of bacterial-type flagellum-dependent cell motility, regulation of bacterial-type flagellum-dependent cell motility |
Specific Function: |
sequence-specific DNA binding, DNA binding, ATP binding, cyclic-di-GMP binding, bacterial-type RNA polymerase core promoter sequence-specific DNA binding, sequence-specific DNA binding bacterial-type RNA polymerase transcription factor activity involved in negative regulation of transcription, sequence-specific DNA binding bacterial-type RNA polymerase transcription factor activity involved in positive regulation of transcription, cyclic-di-GMP binding |
Cellular Location: |
Cytoplasmic |
KEGG Pathways: |
|
KEGG Reactions: |
Not Available |
SMPDB Reactions: |
Not Available |
PseudoCyc/BioCyc Reactions: |
|
Complex Reactions: |
Not Available |
Transports: |
Not Available |
Metabolites: |
Not Available |
GO Classification: |
Function |
---|
sequence-specific DNA binding | DNA binding | ATP binding | cyclic-di-GMP binding | bacterial-type RNA polymerase core promoter sequence-specific DNA binding | sequence-specific DNA binding bacterial-type RNA polymerase transcription factor activity involved in negative regulation of transcription | sequence-specific DNA binding bacterial-type RNA polymerase transcription factor activity involved in positive regulation of transcription | cyclic-di-GMP binding | Process |
---|
regulation of transcription, DNA-templated | positive regulation of cilium-dependent cell motility | positive regulation of cell adhesion | transcription, DNA-templated | positive regulation of cell-substrate adhesion | negative regulation of extracellular matrix assembly | regulation of bacterial-type flagellum-dependent cell motility | regulation of bacterial-type flagellum-dependent cell motility |
|
Gene Properties |
Locus tag: |
PA1097 |
Strand: |
+ |
Entrez Gene ID: |
881960 |
Accession: |
NP_249788.1 |
GI: |
15596294 |
Sequence start: |
1187587 |
Sequence End: |
1189059 |
Sequence Length: |
1472 |
Gene Sequence: |
>PA1097
ATGTGGCGCGAAACCAAACTCTTGCTGATTGACGACAATCTCGATCGCAGTCGCGACCTGGCAGTCATTCTCAACTTCCTCGGCGAAGATCAGCTGACCTGCAACAGCGAGGATTGGCGAGAGGTAGCGGCGGGCCTGAGCAACAGTCGCGAAGCCCTGTGCGTGCTGCTCGGCAGCGTCGAGTCGAAGGGCGGTGCGGTAGAGCTGCTGAAGCAACTGGCCAGTTGGGACGAGTACCTGCCGATCCTGCTGATCGGCGAGCCGGCCCCGGCCGACTGGCCGGAAGAGCTGCGCCGCCGGGTGCTCGCCAGCCTGGAGATGCCGCCCAGCTACAACAAGCTGCTCGATTCCCTGCATCGCGCCCAGGTCTACCGCGAGATGTACGACCAGGCCCGCGAGCGCGGCCGTTCCCGCGAGCCGAACCTGTTCCGCAGCCTGGTCGGCACCAGCCGGGCGATCCAGCAGGTGCGGCAGATGATGCAGCAGGTCGCCGATACCGATGCCAGCGTGCTGATCCTCGGCGAGTCCGGCACCGGCAAGGAAGTGGTGGCGCGCAACCTGCATTACCATTCCAAGCGCCGCGAGGGGCCCTTCGTCCCGGTGAACTGCGGGGCGATCCCGGCGGAACTGCTGGAAAGCGAATTGTTCGGCCACGAGAAGGGTGCCTTCACCGGTGCCATCACCAGTCGTGCCGGACGTTTCGAGCTGGCCAACGGCGGCACCCTGTTCCTCGACGAGATCGGCGACATGCCGCTGCCGATGCAGGTCAAGCTGCTGCGCGTGCTGCAGGAGCGCACCTTCGAAAGGGTTGGCAGCAACAAGACGCAGAACGTCGACGTGCGGATCATCGCCGCGACCCACAAGAACCTCGAGAAGATGATCGAGGACGGCACTTTCCGCGAAGACCTCTACTACCGCCTCAACGTATTCCCCATCGAGATGGCGCCGCTGCGCGAGCGGGTGGAAGACATCGCCCTGCTGCTCAACGAACTGATCTCGCGGATGGAGCATGAGAAGCGCGGGTCGATCCGCTTCAACTCGGCGGCAATCATGTCGCTCTGCCGCCACGACTGGCCGGGCAACGTCCGCGAACTGGCGAACCTGGTGGAGCGCCTGGCGATCATGCATCCCTACGGGGTGATCGGGGTCGGCGAACTGCCGAAGAAATTCCGCCATGTCGACGACGAGGACGAGCAACTCGCCAGCAGCCTGCGCGAAGAGCTGGAAGAGCGCGCGGCGATCAACGCCGGGCTGCCGGGAATGGACGCGCCGGCGATGCTGCCGGCCGAAGGCCTGGACCTCAAGGACTACCTGGCCAACCTCGAGCAGGGCCTGATCCAGCAGGCCCTCGACGACGCCGGCGGAGTGGTCGCGCGGGCCGCCGAACGCCTGCGCATCCGCCGCACCACGCTGGTAGAGAAGATGCGCAAGTACGGCATGAGCCGGCGTGACGACGACCTGTCGGATGATTGA |
Protein Properties |
Protein Residues: |
490 |
Protein Molecular Weight: |
55.3 kDa |
Protein Theoretical pI: |
5.03 |
Hydropathicity (GRAVY score): |
-0.364 |
Charge at pH 7 (predicted): |
-13.91 |
Protein Sequence: |
>PA1097
MWRETKLLLIDDNLDRSRDLAVILNFLGEDQLTCNSEDWREVAAGLSNSREALCVLLGSVESKGGAVELLKQLASWDEYLPILLIGEPAPADWPEELRRRVLASLEMPPSYNKLLDSLHRAQVYREMYDQARERGRSREPNLFRSLVGTSRAIQQVRQMMQQVADTDASVLILGESGTGKEVVARNLHYHSKRREGPFVPVNCGAIPAELLESELFGHEKGAFTGAITSRAGRFELANGGTLFLDEIGDMPLPMQVKLLRVLQERTFERVGSNKTQNVDVRIIAATHKNLEKMIEDGTFREDLYYRLNVFPIEMAPLRERVEDIALLLNELISRMEHEKRGSIRFNSAAIMSLCRHDWPGNVRELANLVERLAIMHPYGVIGVGELPKKFRHVDDEDEQLASSLREELEERAAINAGLPGMDAPAMLPAEGLDLKDYLANLEQGLIQQALDDAGGVVARAAERLRIRRTTLVEKMRKYGMSRRDDDLSDD |
References |
External Links: |
|
General Reference: |
PaperBLAST - Find papers about PA1097 and its homologs
|