translated portion of tmRNA gene ssrA (PA0826.1)
| Identification | |||||||||
|---|---|---|---|---|---|---|---|---|---|
| Name: | translated portion of tmRNA gene ssrA | ||||||||
| Synonyms: | Not Available | ||||||||
| Gene Name: | Not Available | ||||||||
| Enzyme Class: | Not Available | ||||||||
| Biological Properties | |||||||||
| General Function: | cellular amino acid metabolic process | ||||||||
| Specific Function: | Not Available | ||||||||
| Cellular Location: | Unknown | ||||||||
| KEGG Pathways: |
| ||||||||
| KEGG Reactions: | Not Available | ||||||||
| SMPDB Reactions: | Not Available | ||||||||
| PseudoCyc/BioCyc Reactions: |
| ||||||||
| Complex Reactions: | Not Available | ||||||||
| Transports: | Not Available | ||||||||
| Metabolites: | Not Available | ||||||||
| GO Classification: |
| ||||||||
| Gene Properties | |||||||||
| Locus tag: | PA0826.1 | ||||||||
| Strand: | - | ||||||||
| Entrez Gene ID: | Not Available | ||||||||
| Accession: | Not Available | ||||||||
| GI: | 308198345 | ||||||||
| Sequence start: | 901746 | ||||||||
| Sequence End: | 901778 | ||||||||
| Sequence Length: | 32 | ||||||||
| Gene Sequence: |
>PA0826.1 GCCAACGACGACAACTACGCTCTAGCTGCTTAA | ||||||||
| Protein Properties | |||||||||
| Protein Residues: | 10 | ||||||||
| Protein Molecular Weight: | 1 kDa | ||||||||
| Protein Theoretical pI: | 3.49 | ||||||||
| Hydropathicity (GRAVY score): | -0.43 | ||||||||
| Charge at pH 7 (predicted): | -2.02 | ||||||||
| Protein Sequence: |
>PA0826.1 ANDDNYALAA | ||||||||
| References | |||||||||
| External Links: |
| ||||||||
| General Reference: | PaperBLAST - Find papers about PA0826.1 and its homologs | ||||||||