sigma factor AlgU sigma factor AlgT (PA0762)

Identification
Name: sigma factor AlgU sigma factor AlgT
Synonyms: algT
Gene Name: algU
Enzyme Class: Not Available
Biological Properties
General Function: negative regulation of bacterial-type flagellum-dependent cell motility, regulation of polysaccharide biosynthetic process, DNA-templated transcription, initiation, regulation of transcription, DNA-templated, positive regulation of response to oxidative stress, positive regulation of cell adhesion involved in single-species biofilm formation, positive regulation of single-species biofilm formation on inanimate substrate, cellular response to antibiotic, positive regulation of cellular response to heat, pathogenesis, cellular response to cell envelope stress, regulation of polysaccharide biosynthetic process
Specific Function: DNA binding, sequence-specific DNA binding transcription factor activity, sigma factor activity
Cellular Location: Cytoplasmic
KEGG Pathways:
    KEGG Reactions: Not Available
    SMPDB Reactions: Not Available
    PseudoCyc/BioCyc Reactions:
    Complex Reactions: Not Available
    Transports: Not Available
    Metabolites: Not Available
    GO Classification:
    Component
    cytosolic DNA-directed RNA polymerase complex
    Function
    DNA binding
    sequence-specific DNA binding transcription factor activity
    sigma factor activity
    Process
    negative regulation of bacterial-type flagellum-dependent cell motility
    regulation of polysaccharide biosynthetic process
    DNA-templated transcription, initiation
    regulation of transcription, DNA-templated
    positive regulation of response to oxidative stress
    positive regulation of cell adhesion involved in single-species biofilm formation
    positive regulation of single-species biofilm formation on inanimate substrate
    cellular response to antibiotic
    positive regulation of cellular response to heat
    pathogenesis
    cellular response to cell envelope stress
    regulation of polysaccharide biosynthetic process
    Gene Properties
    Locus tag: PA0762
    Strand: +
    Entrez Gene ID: 882125
    Accession: NP_249453.1
    GI: 15595959
    Sequence start: 831301
    Sequence End: 831882
    Sequence Length: 581
    Gene Sequence: 
    >PA0762
ATGCTAACCCAGGAACAGGATCAGCAACTGGTTGAACGGGTACAGCGCGGAGACAAGCGGGCTTTCGATCTGCTGGTACTGAAATACCAGCACAAGATACTGGGATTGATCGTGCGGTTCGTGCACGACGCCCAGGAAGCCCAGGACGTAGCGCAGGAAGCCTTCATCAAGGCATACCGTGCGCTCGGCAATTTCCGCGGCGATAGTGCTTTTTATACCTGGCTGTATCGGATCGCCATCAACACCGCGAAGAACCACCTGGTCGCTCGCGGGCGTCGGCCACCGGACAGCGATGTGACCGCAGAGGATGCGGAGTTCTTCGAGGGCGACCACGCCCTGAAGGACATCGAGTCGCCGGAACGGGCGATGTTGCGGGATGAGATCGAGGCCACCGTGCACCAGACCATCCAGCAGTTGCCCGAGGATTTGCGCACGGCCCTGACCCTGCGCGAGTTCGAAGGTTTGAGTTACGAAGATATCGCCACCGTGATGCAGTGTCCGGTGGGGACGGTACGGTCGCGGATCTTCCGCGCTCGTGAAGCAATCGACAAAGCTCTGCAGCCTTTGTTGCGAGAAGCCTGA
    Protein Properties
    Protein Residues: 193
    Protein Molecular Weight: 22.2 kDa
    Protein Theoretical pI: 5.38
    Hydropathicity (GRAVY score): -0.428
    Charge at pH 7 (predicted): -4.83
    Protein Sequence: 
    >PA0762
MLTQEQDQQLVERVQRGDKRAFDLLVLKYQHKILGLIVRFVHDAQEAQDVAQEAFIKAYRALGNFRGDSAFYTWLYRIAINTAKNHLVARGRRPPDSDVTAEDAEFFEGDHALKDIESPERAMLRDEIEATVHQTIQQLPEDLRTALTLREFEGLSYEDIATVMQCPVGTVRSRIFRAREAIDKALQPLLREA
    References
    External Links:
    Resource Link
    Genome ID: PA0762
    Entrez Gene ID: 882125
    NCBI Protein ID: 15595959
    General Reference: PaperBLAST - Find papers about PA0762 and its homologs