repressor, PtrB New product name: repressor, PtrB (PA0612)
| Identification | |||||||||
|---|---|---|---|---|---|---|---|---|---|
| Name: | repressor, PtrB New product name: repressor, PtrB | ||||||||
| Synonyms: | ptrB | ||||||||
| Gene Name: | ptrB | ||||||||
| Enzyme Class: | Not Available | ||||||||
| Biological Properties | |||||||||
| General Function: | positive regulation of secondary metabolite biosynthetic process, positive regulation of cellular biosynthetic process | ||||||||
| Specific Function: | zinc ion binding | ||||||||
| Cellular Location: | Unknown | ||||||||
| KEGG Pathways: |
| ||||||||
| KEGG Reactions: | Not Available | ||||||||
| SMPDB Reactions: | Not Available | ||||||||
| PseudoCyc/BioCyc Reactions: |
| ||||||||
| Complex Reactions: | Not Available | ||||||||
| Transports: | Not Available | ||||||||
| Metabolites: | Not Available | ||||||||
| GO Classification: |
| ||||||||
| Gene Properties | |||||||||
| Locus tag: | PA0612 | ||||||||
| Strand: | + | ||||||||
| Entrez Gene ID: | 878190 | ||||||||
| Accession: | NP_249303.1 | ||||||||
| GI: | 15595809 | ||||||||
| Sequence start: | 674419 | ||||||||
| Sequence End: | 674619 | ||||||||
| Sequence Length: | 200 | ||||||||
| Gene Sequence: |
>PA0612 ATGGCTGACCTTGCCGATCACGCCAACGAACTGGTCCTGGCTCGCCTCGACGGCCTCCTGGCGGCGCGCCCGGCGCTGGCCATCCGCGAGTCCGCGGAAGACTGCGAGGACTGCGGCGAGCCCATTCCCCAGGCGCGCCGCCGGGCGGCACCGGGCTGCAGTCGCTGCATCGACTGCCAGGACCGCCACGAGCGCCGTTGA | ||||||||
| Protein Properties | |||||||||
| Protein Residues: | 66 | ||||||||
| Protein Molecular Weight: | 7.3 kDa | ||||||||
| Protein Theoretical pI: | 5.06 | ||||||||
| Hydropathicity (GRAVY score): | -0.55 | ||||||||
| Charge at pH 7 (predicted): | -2.68 | ||||||||
| Protein Sequence: |
>PA0612 MADLADHANELVLARLDGLLAARPALAIRESAEDCEDCGEPIPQARRRAAPGCSRCIDCQDRHERR | ||||||||
| References | |||||||||
| External Links: |
| ||||||||
| General Reference: | PaperBLAST - Find papers about PA0612 and its homologs | ||||||||