
repressor, PtrB New product name: repressor, PtrB (PA0612)
Identification | |||||||||
---|---|---|---|---|---|---|---|---|---|
Name: | repressor, PtrB New product name: repressor, PtrB | ||||||||
Synonyms: | ptrB | ||||||||
Gene Name: | ptrB | ||||||||
Enzyme Class: | Not Available | ||||||||
Biological Properties | |||||||||
General Function: | positive regulation of secondary metabolite biosynthetic process, positive regulation of cellular biosynthetic process | ||||||||
Specific Function: | zinc ion binding | ||||||||
Cellular Location: | Unknown | ||||||||
KEGG Pathways: |
| ||||||||
KEGG Reactions: | Not Available | ||||||||
SMPDB Reactions: | Not Available | ||||||||
PseudoCyc/BioCyc Reactions: |
| ||||||||
Complex Reactions: | Not Available | ||||||||
Transports: | Not Available | ||||||||
Metabolites: | Not Available | ||||||||
GO Classification: |
| ||||||||
Gene Properties | |||||||||
Locus tag: | PA0612 | ||||||||
Strand: | + | ||||||||
Entrez Gene ID: | 878190 | ||||||||
Accession: | NP_249303.1 | ||||||||
GI: | 15595809 | ||||||||
Sequence start: | 674419 | ||||||||
Sequence End: | 674619 | ||||||||
Sequence Length: | 200 | ||||||||
Gene Sequence: |
>PA0612 ATGGCTGACCTTGCCGATCACGCCAACGAACTGGTCCTGGCTCGCCTCGACGGCCTCCTGGCGGCGCGCCCGGCGCTGGCCATCCGCGAGTCCGCGGAAGACTGCGAGGACTGCGGCGAGCCCATTCCCCAGGCGCGCCGCCGGGCGGCACCGGGCTGCAGTCGCTGCATCGACTGCCAGGACCGCCACGAGCGCCGTTGA | ||||||||
Protein Properties | |||||||||
Protein Residues: | 66 | ||||||||
Protein Molecular Weight: | 7.3 kDa | ||||||||
Protein Theoretical pI: | 5.06 | ||||||||
Hydropathicity (GRAVY score): | -0.55 | ||||||||
Charge at pH 7 (predicted): | -2.68 | ||||||||
Protein Sequence: |
>PA0612 MADLADHANELVLARLDGLLAARPALAIRESAEDCEDCGEPIPQARRRAAPGCSRCIDCQDRHERR | ||||||||
References | |||||||||
External Links: |
| ||||||||
General Reference: | PaperBLAST - Find papers about PA0612 and its homologs |