regulatory RNA RsmY (PA0527.1)
| Identification | |||||||||
|---|---|---|---|---|---|---|---|---|---|
| Name: | regulatory RNA RsmY | ||||||||
| Synonyms: | Not Available | ||||||||
| Gene Name: | rsmY | ||||||||
| Enzyme Class: | Not Available | ||||||||
| Biological Properties | |||||||||
| General Function: | regulation of translation, ncRNA-mediated, regulation of secondary metabolic process, quorum sensing, regulation of single-species biofilm formation, protein secretion by the type III secretion system, protein secretion by the type VI secretion system | ||||||||
| Specific Function: | Not Available | ||||||||
| Cellular Location: | Not Available | ||||||||
| KEGG Pathways: |
| ||||||||
| KEGG Reactions: | Not Available | ||||||||
| SMPDB Reactions: | Not Available | ||||||||
| PseudoCyc/BioCyc Reactions: |
| ||||||||
| Complex Reactions: | Not Available | ||||||||
| Transports: | Not Available | ||||||||
| Metabolites: | Not Available | ||||||||
| GO Classification: |
| ||||||||
| Gene Properties | |||||||||
| Locus tag: | PA0527.1 | ||||||||
| Strand: | + | ||||||||
| Entrez Gene ID: | 4179186 | ||||||||
| Accession: | Not Available | ||||||||
| GI: | Not Available | ||||||||
| Sequence start: | 586867 | ||||||||
| Sequence End: | 586990 | ||||||||
| Sequence Length: | 123 | ||||||||
| Gene Sequence: |
>PA0527.1 GTCAGGACATTGCGCAGGAAGCGCCAAAGACAATACGGAAACTCAGGGAATCCACCATGGATGGTGGCGTAGCACGGATGTCAGGATAGAGGTCTGCAAAACCCCGCCCAAAAGGCGGGGTTTT | ||||||||
| Protein Properties | |||||||||
| Protein Residues: | 41 | ||||||||
| Protein Molecular Weight: | Not Available kDa | ||||||||
| Protein Theoretical pI: | Not Available | ||||||||
| Hydropathicity (GRAVY score): | Not Available | ||||||||
| Charge at pH 7 (predicted): | Not Available | ||||||||
| Protein Sequence: |
>PA0527.1
Not Available | ||||||||
| References | |||||||||
| External Links: |
| ||||||||
| General Reference: | PaperBLAST - Find papers about PA0527.1 and its homologs | ||||||||